Encoding RIP from Elaeis Guaneensis Jacq

Encoding commit from Elaeis Guaneensis JacqDetection and expression profiling of two novel transcripts encoding deplume from Elaeis guaneensis Jacq. in Ganoderma boninense fundamental interaction1. IntroductionAmong several fossil cover colour-producing plants, crude palm (Elaeis guineensis) is a tropical crop which is exclusively grown for crude production. Its high oil yield is extracted from oil palms thick fleshy mesocarp which is extremely rich in oil (80% of dry mass). Furthermore, oil palm has the highest oil production (oil per unit land) comp ared to other oil-producing plants. The extracted oil has been employ widely for several applications including, food, cosmetics, and bio-fuel (Paterson 2007 Murphy 2009 Alizadeh et al. 2013).Among various diseases , the basal stem rot (BSR) is known to be the most serious disease in oil palm (Ho and Nawawi 1985). Furthermore, the BSR is caused by Ganoderma boninense which is considered specifically as a white rot fungus. The l ignin is broken by the fungus leaving whitish cellulose exposed (Paterson 2007). The infection process is initiated when the oil palm stemma are penetrated by fungal mycelia, which is spread out to the stem bole, after which the trunk eventually collapses (Rees et al. 2009). Malaysia and Ind 1sia have suffered the most severe losses from the BSR furthermore, the diseases has been identified in Malaysia several decades ago (Ho and Nawawi 1985 Idris et al. 2004 Rees et al. 2007).Oil palms of antithetic genetic origins have shown to have guard to BSR. However, the genes involved in the resistance of oil palms against G. Boninense were unbeknown(predicate) (Idris et al. 2004 Durand-Gasselin et al. 2005). Recently, few defence related genes were identified in oil palm. The major pathogen on oil palm in Malaysia has been identified as G. boninense Pat. stand rots of oil palm caused by species of Ganoderma are a major threat to the sustainability of the oil palm production. In this s tudy, we have isolated one cDNA encoding RIPs EST, from oil palm. Its expression in oil palm reconcile infected by G. boninese was investigated to shed light on its potential involvement during archaeozoic disease development.2. Materials and methods2.1 Sample preparationA total of 24 six-month-old oil palm seedlings (Elaeis guineensis Jacq., DxP, GH500 series) were purchased from Sime Darby Plantation Sdn. Bhd. (Banting Malaysia) and divided into two groups with 12 seedlings in individually group, one of these groups were treated with Ganoderma boninense Pat. Strain PER71, era the remaining group served as controls. Seedlings treated with G.boninense were inoculated by sitting each seedling on rubber woodblock fully grown with G.boninense PER71 while the other group of seedlings were inoculated with fungal surface mulch as described by (Alizadeh et al., 2011). Three biological replicates of the seedlings were harvested from each treatment at 4, 8, 12 wpi, respectively. The leav es, free radicals and stem cell were frozen in liquid nitrogen and stored at -80C (Tan et al., 2013).2.2 RNA extractionTotal RNA was extracted from treated and untreated oil palm foundation tissue papers using a modified CTAB method briefly, 0.1 g tissue was ground in liquid nitrogen into a very escort powder. The powder was immediately transferred into 1.5 ml extraction CTAB buffer 2% (w/v) cetyl trimethyl ammonium bromide, CTAB 100mM Tris-HCl, pH 8.0 2M NaCl 25 mM ethylenedia biteteraacetic erosive, EDTA pH 8.0 2% (w/v) polyvinylpyrrolidone, PVP and 2% (v/v) -mercaptoethanool. Equal hoi polloi of chloroform/isoamylalcohol (241, v/v) was added into the tube and centrifuged at 12,857 g for 15 min at 4C. The upper layer was transferred into a new tube and fitting volume of phenol/chloroform/isoamylalcohol (25241, v/v/v) was added and centrifuged. This step was repeated until a clear supernatant was obtained. The supernatant was adjusted to a final exam concentration of 2M LiCl , and incubated at 4C for overnight, and accordingly centrifuged. The RNA was dissolved in 5ml diethypyrocarbonate (DEPC) treated water. An equal volume of chloroform/isoamylalcohol was added, mixed, and centrifuged at 12,857 for 30 min at 4C. Precipitation of RNA was performed by adding 0.1 vol of 3M sodium acetate (pH 5.2), 2 vol 100% ethanol and incubated at -80C for overnight. After centrifugation, the pellet was wash using 70% ethanol and dissolved in 20ul DEPC-treated water. The quality of RNA was examined by using a Nanodrop( BioRad) at 230, 260 and 280 nm. The RNA integrity was examined using 1.5% agarose colloidal gel electrophoresis. The RNA was treated with DNase I (Qiagen, USA) following the manufacturers instructions.Figure Total RNA from various treated and untreated oil palm tissues. alley A Untreated control seedling. Lane B Treated seedlings. 1) Leaf. 2) Basal stem. 3) Root3. Semi-quantitative Reverse transcriptase (RT-) PCR3.1 Isolation of cDNAOmniscript Reve rse Transcriptase outfit (Qiagen Kit) was used for cDNA synthesis by the following kit manuscript. To obtain the sequence of cDNA from oil palm, gene specific primers were designed based on oil palm expressed sequence tag (EST) (Ho, 2010) and RIPs type I alignments, using primer 3 version 0.4.0(frodo.wi.mit.edu).3.2 Sequence compendium of cDNASemi-quantitative Reverse transcriptase (RT-) PCR was performed on EST using PCR machine with Reverse transcriptase enzyme. Equal amounts of RNA (1ug) extracted from control and treated oil palm root samples were converted into cDNA by using the Omniscript two step Reverse Transcription Kit for cDNA Synthesis (Qiagen, USA) following the manufacturers instructions. The resulted sequences shown remarkable similarities to RIP (Naher et al., 2011).3.3 Expression profilingExpression levels were calculated by Quantity One 1-D Analysis software 4.6.5 (Bio-Rad) according to the manufacturers instructions. PCR products were resolved on 1.5%(w/v) agaro se gel (1xTAE) with a DNA mass standard marker (MassRuler TM DNA Ladder, Fermentas). The density of the DNA mass standard dilution series was used to buckle under calibration curve for absolute quantisation of sample bands by linear regression with extrapolation to zero for each experiment. The density of each sample band was then converted to an absolute quantity using the calibration curve. For each sample band was then converted to an absolute quantity using the calibration curve. For each experiment, the relative band quantity obtained by densitometrric synopsis was normalized to the value of the internal control (house-keeping gene) bands which were run in parallel. Identification of differentially expressed genes was based on consistent ford-change across experimental replicates relative to untreated negative control. Fold changes of 2- fold or 0.5-fold were considered as significant.3.4 Statistical analysisA one-way analysis of variance (ANOVA) was used to determine statist ical differences (SPSS version 17SPSS Inc., Chicago, IL). When the ANOVA was significant at P 0.05 the Duncans multiple range test was used for means comparison. The t-test was used to compare between group means.(Alizadeh et al., 2011)4. Results4.1 sequence analysis EgRIP-1bThe overtone cDNA of EgRIP-1b (Dr. Ho personal comment) encodes a putative type I ribosome inactivating protein. The partial sequence consists 167 nucleotide residues. (Fig. 2). This sequence has the highest identity with RIP type I from Populus trichocarpa (98%, XP_002328056.1), Hordeum vulgare (90%, AAA32951.1) and Chain A, Structure Of Mutant Rip From barley Seeds (90%, 4FBA_A). The NODE_77734GT was classified in a RIP-like superfamily. A putative conserved domain of catalytic residues and some RIP family domain were in this sequence, including that it is a member of the RIP superfamily.(Fig. 5)(Naher et al., 2011)M I C E S I R F E R I S E F L A T E F P G S S K P P KTGATGATCTGCGAGTCGATTAGATTCGAACGCATCTCCGAA TTTCTTGCTACCGAATTCCCCGGCAGTTCGAAACCCCCTAAAW M P A L E H G W G D L S A A L L R A D A N P D R P FTGGATGCCGGCACTCGAGCACGGCTGGGGAGATCTCTTTGCCGCGTTGCTGCGCGCCGATGCCAATCCCGACCGTCCCTTCAFig. 2. The nucleotide and deduced amino acid sequences of NODE_77734GT.4.2 sequence analysis EgRIP-1aThe partial cDNA sequence EgRIP-1a (GenBank ID ) encodes a protein of 17 amino acid. The sequence consists 178 nucleotides (Fig. 3). This sequences has the highest identity with other type I RIPs from Nicotiana tabacum (47%, ABY71831.1), Musa acuminate (47%, ABY71832.1), Alocasia macrorrhizos (47%, ABY71829.1), agave sisalana (47%, ABY71828.1) (Fig. 6.a) and (Fig. 6.b)M R P T P N F H Y E W S ACAGGATTCCAGCCGAGCTCCTGCGATAGCCGAACTTCTACCACATGCGACCTACTCCAAACTTCCACTACGAGTGGTCTGCTCL S K QTCTCCAAACAAFig. 3. The nucleotide and deduced amino acid sequences of EgRIP-1a.Fig. 4 multiple alignment of NODE with other type I RIPs. Amino acid residues that are alike in all sequences are highlighted in black while amino acid residues that are highly conserved are highlighted in gray dashes even up gaps introduced to maximize the alignment.(a)(b)Fig. 5 Multiple alignment of EgRIP-1a with other RIPs. The protein sequences and their accession numbers used for analysis of detected sequence. a) Nucleotide residues that are highly conserved are highlighted in gray dashes represent gaps introduced to maximize the alignment. b) Amino acid residues that are identical in all sequences are highlighted in black with amino acid residues that are highly conserved are highlighted in gray dashes represent gaps introduced to maximize the alignment.4.3 Expression profiles (of RIP) in oil palm root upon Ganoderma inoculationA total of 2 cDNA sequences encoding putative defence-related proteins from oil palm were chosen for gene expression profiling in this study. A relative semi-quantification of EgRIP-1b and EgRIP-1b transcripts were performed by calibrating the expression of each gene with an endogenous control, actin. Fig.6 Shows the relative expression level of EgRIP-1b in roots and basal stems in response to the inoculation of G. boninense at different cadence points compared with that of negative control plants. In G. boninense-treated plants, the gene expression of EgRIP-1b in oil palm roots at 2 wpi was induced. The expression level were n- and n-fold of the fair root tissues at 8 and 12 wpi, respectively.(Naher et al., 2011) The expression level was studied in 3 replication of each sample, there were no significant (P0.05) differences in expression levels in inoculated plants (Alizadeh et al., 2011).EgRIP-1a was up-regulated n-fold and n-fold at X wpi, respectively before the transcript level decrease at Y wpi in oil palm root tissue following G.boninense infection (Fig). EgRIP-1a expression level were m-, m- and m-fold of the uninfected basal stem tissues at 2,4, 8 and 12 wpi, respectively. EgRIP-1b and EgRIP-1a were not expressed in time zero, untreated samples and leaf tissues.(I) dis eased (II) healthy(a) (b) (c) Fig. 6. Differential expression of EgRIP-1b in variety tissues in response to I) G.boninese treatment compare to those in II )control.. a) root tissue, b) stem cell tissue, c) standard (Rippmann et al., 1997)a) b)Fig. 7. Expression level mean in each biological replicate a) in root b) in stem(I) diseased (II) healthy(a) (b) (c) Fig. 8. Differential expression of EgRIP-1a in variety tissues in response to I) G.boninese treatment compare to those in II) control.. a) root tissue, b) stem cell tissue, c) leaf tissue d)control (Rippmann et al., 1997)a) b)Fig. 9. Expression level mean in each biological replicate a) in root b) in stemFig. 10. Semi-quantification of oil palm EgRIP-1a and EgRIP-1b expression levels in root tissues at 2-12 week after inoculation with G.boninense. Significant up-regulation of gene expression compared to untreated negative control.ReferencesAlizadeh F, Abdullah SNA, Chong PP, Selamat A Bin (2013) Expression Analysis of suet y Acid Biosynthetic Pathway Genes during Interactions of Oil Palm (Elaeis guineensis Jacq.) with the Pathogenic Ganoderma boninense and Symbiotic Trichoderma harzianum Fungal Organisms. Plant Molecular Biology Reporter. inside 10.1007/s11105-013-0595-yDurand-Gasselin T, Asmady H, Flori a, et al. (2005) Possible sources of genetic resistance in oil palm (Elaeis guineensis Jacq.) to basal stem rot caused by Ganoderma boninenseprospects for future breeding. Mycopathologia 15993100. doi 10.1007/s11046-004-4429-1Ho YW, Nawawi A (1985) Ganoderma boninense Pat . from Basal Stem Rot of Oil Palm ( Elaeis guineensis ) in Peninsular Malaysia. Pertanika 8425428.Idris AS, Kushairi A, Ismail S, Ariffin D (2004) SELECTION FOR PARTIAL RESISTANCE IN OIL PALM PROGENIES TO Ganoderma ultra STEM ROT. Journal of Oil Palm Research 161218.Murphy DJ (2009) Oil palm future prospects for yield and quality improvements. lipid Technology 21257260. doi 10.1002/lite.200900067Paterson R (2007) Ganoderma disease of oil palmA white rot perspective necessary for integrated control. Crop Protection. doi 10.1016/j.cropro.2006.11.009pilotti CA (2005) Stem rots of oil palm caused by Ganoderma boninense Pathogen biology and epidemiology. Mycopathologia 159129137.Rees RW, Flood J, Hasan Y, et al. (2009) Basal stem rot of oil palm ( Elaeis guineensis ) mode of root infection and lower stem invasion by Ganoderma boninense. Plant Pathology 58982989. doi 10.1111/j.1365-3059.2009.02100.xRees RW, Flood J, Hasan Y, Cooper RM (2007) Effects of inoculum potential, shading and soil temperature on root infection of oil palm seedlings by the basal stem rot pathogen Ganoderma boninense. Plant Pathology. doi 10.1111/j.1365-3059.2007.01621.xTan Y-C, Yeoh K-A, Wong M-Y, Ho C-L (2013) Expression profiles of putative defence-related proteins in oil palm (Elaeis guineensis) colonized by Ganoderma boninense. Journal of plant physiology. doi 10.1016/j.jplph.2013.05.009